View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0218_high_54 (Length: 244)

Name: NF0218_high_54
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0218_high_54
NF0218_high_54
[»] chr5 (1 HSPs)
chr5 (1-210)||(18295983-18296187)


Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 18296187 - 18295983
Alignment:
1 gaatgtatattgacttgctccataagtaatctcatattaggactcttattaggcgaatcttgagcgattgatgaacacttatcagtgataaagttagaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18296187 gaatgtatattgacttgctccataagtaatctcatattaggactcttattaggcgaatcttgagcgattgatgaacacttatcagtgataaagttagaga 18296088  T
101 ctcttgctgagagctgagaatgaatgttatgaggaatatgcaagaccatatataacaagaggcgaggctcaccacacgaagcatacatcgaaaagttgac 200  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||     ||||||||||||| |||||| |||||||||||||||    
18296087 ctcttgctgagagctgagaatgaatgttacgaggaatatgcaagaccatatataacaag-----aggctcaccacactaagcatccatcgaaaagttgac 18295993  T
201 ctgacgacca 210  Q
    ||||| ||||    
18295992 ctgaccacca 18295983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University