View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_17 (Length: 453)
Name: NF0218_low_17
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 220 - 438
Target Start/End: Complemental strand, 297979 - 297764
Alignment:
Q |
220 |
gtcctcatgctaattatatatgctagtgcctgcgattgcgaaggttgttgttggcagtgacatgagcagcagtgttgttgttagagacgaggggctggaa |
319 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
297979 |
gtcctcatgataattatatatgctagtgcctgcgattgcgaaggttgttgttggcagtgacatgagcagcagtgttgtttttagagacgaggggctggaa |
297880 |
T |
 |
Q |
320 |
atgatgatcagattcgcgagttcttctgcgaaaggaaccattatcaggtcccaatagcaaacactttgagctatcttctaaatgttgtaataaggtgttc |
419 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
297879 |
atgatgatcagattcgcgagttcttctgcgaaaggaaccattatcaggtcccaatagcaaacactttgagcta---tctgaatgttgtaataaggtgtta |
297783 |
T |
 |
Q |
420 |
atgtgctcaaacttttgct |
438 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
297782 |
atgtgctcaaacttttgct |
297764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1400 times since January 2019
Visitors: 2391