View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0218_low_36 (Length: 357)

Name: NF0218_low_36
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0218_low_36
NF0218_low_36
[»] chr8 (1 HSPs)
chr8 (283-345)||(454724-454786)


Alignment Details
Target: chr8 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 283 - 345
Target Start/End: Original strand, 454724 - 454786
Alignment:
283 ttttctccatctcttcatattcacaaataagagtcgtattttggaaagtaaagatgggatatt 345  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
454724 ttttctccatctcttcatattcacaaataagagtcgtattttggaaagtaaagatgggatatt 454786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University