View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_36 (Length: 357)
Name: NF0218_low_36
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 283 - 345
Target Start/End: Original strand, 454724 - 454786
Alignment:
Q |
283 |
ttttctccatctcttcatattcacaaataagagtcgtattttggaaagtaaagatgggatatt |
345 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
454724 |
ttttctccatctcttcatattcacaaataagagtcgtattttggaaagtaaagatgggatatt |
454786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University