View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_41 (Length: 342)
Name: NF0218_low_41
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 140 - 306
Target Start/End: Original strand, 50554010 - 50554176
Alignment:
| Q |
140 |
aaagattgatgtaacaacagctacagcccttaagaagaatttattttagaatacgatcaaaatgttagttccagcttatgtaaccttttcatgattgaat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50554010 |
aaagattgatgtaacaacagctacagccctcaagaagaatttattttagaatacgatcaaaatgttagttccagcttatgcaaccttttcatgattgaat |
50554109 |
T |
|
| Q |
240 |
tgcaggatgctgtgagttcattttcaacttgtggcggactaacaaactcccaaaactttactcccaa |
306 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50554110 |
tgcaggatgttgtgagttcattttcaacttgtggtggactaacaaactcccaaaactttactcccaa |
50554176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 30 - 135
Target Start/End: Original strand, 50553802 - 50553908
Alignment:
| Q |
30 |
atttggtctttctattttttcttaagcatgtcaacatgcaagacttcgtcc-attcccatcatttatttataaagtactcctaaatcctaatactaccgc |
128 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50553802 |
atttgctctttctattttttcttaagcatgtgaacatgcaagacttcgtcccattcccatcatttatttataaagtactcctaaatcctaatactaccgc |
50553901 |
T |
|
| Q |
129 |
cactatc |
135 |
Q |
| |
|
||||||| |
|
|
| T |
50553902 |
cactatc |
50553908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1304 times since January 2019
Visitors: 2391