View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_45 (Length: 298)
Name: NF0218_low_45
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 215 - 287
Target Start/End: Original strand, 26469036 - 26469108
Alignment:
Q |
215 |
gagggagggaactgactgagcgaggtcaccgagctgacgcaagaacccaacgagtccactcatagcaacagct |
287 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26469036 |
gagggagggaactgactgagcgaggtcaccgagctgacgcaagaacccaacgagtccactcatagcaacagct |
26469108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 215 - 287
Target Start/End: Original strand, 26545408 - 26545480
Alignment:
Q |
215 |
gagggagggaactgactgagcgaggtcaccgagctgacgcaagaacccaacgagtccactcatagcaacagct |
287 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26545408 |
gagggagggaactgactgagcgaggtcaccgagctgacgcaagaacccaacgagtccactcatagcaacagct |
26545480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 132 - 189
Target Start/End: Original strand, 26468955 - 26469012
Alignment:
Q |
132 |
ctcaatgcaataacaaactatgaacacaattcaccatcaagcaagaacaaaaacagtt |
189 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26468955 |
ctcaatgcaataacaaactatgaacacaattcaccatcaagcaagaacaaaaacagtt |
26469012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 132 - 189
Target Start/End: Original strand, 26545327 - 26545384
Alignment:
Q |
132 |
ctcaatgcaataacaaactatgaacacaattcaccatcaagcaagaacaaaaacagtt |
189 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26545327 |
ctcaatgcaataacaaactatgaacacaattcaccatcaagcaagaacaaaaacagtt |
26545384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2451 times since January 2019
Visitors: 2401