View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_50 (Length: 260)
Name: NF0218_low_50
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 9800305 - 9800199
Alignment:
| Q |
1 |
tttccacttttgctggtgttgcaatggcagatgaagaacctaaaagaggtaccccagaagccaagaaaaagtatgcccctgtttgtgtcactatggcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
9800305 |
tttccacttttgctggtgttgcaatggcagatgaagaacctaaaagaggtaccccagaagccaagaaaaagtacgcccctgtttgtgtcactatgccaac |
9800206 |
T |
 |
| Q |
101 |
agctagg |
107 |
Q |
| |
|
||||||| |
|
|
| T |
9800205 |
agctagg |
9800199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 10 - 107
Target Start/End: Complemental strand, 9801885 - 9801788
Alignment:
| Q |
10 |
ttgctggtgttgcaatggcagatgaagaacctaaaagaggtaccccagaagccaagaaaaagtatgcccctgtttgtgtcactatggcaacagctagg |
107 |
Q |
| |
|
||||||| ||||||||||||||||| ||||| | ||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
9801885 |
ttgctggggttgcaatggcagatgatgaaccaagaagaggtactccagaagccaagaaaaagtatggccctgtttgtgtcactaacccaacagctagg |
9801788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 240
Target Start/End: Complemental strand, 33548952 - 33548912
Alignment:
| Q |
200 |
cttcattcattcaatttaataaataatacatcggacaacac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33548952 |
cttcattcattcaatttaataaataatacatcggacaacac |
33548912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University