View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_51 (Length: 260)
Name: NF0218_low_51
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 42 - 189
Target Start/End: Original strand, 15595839 - 15595987
Alignment:
Q |
42 |
cgacggtaataaatcttctcgtgaagaggattcttcttctgattctgtttccacggccctcgttcccgttgctccttcacatttcactctcaaaaacatt |
141 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
15595839 |
cgacggtaataaatcttctcgtgaagaggattcttcttctgactctgtttccacggccctcgttcccgtcgctccttcacatttcactctcaaaaacatt |
15595938 |
T |
 |
Q |
142 |
gcaagt-aaatcgacctcttggatattctcatcgtagccggagttggta |
189 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15595939 |
gcaagtcaaatcgacctcttggatattctcatcgtagccggagttggta |
15595987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1684 times since January 2019
Visitors: 2392