View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_56 (Length: 253)
Name: NF0218_low_56
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218_low_56 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 25 - 253
Target Start/End: Original strand, 31563219 - 31563447
Alignment:
Q |
25 |
catcacctgaacccagtctccctccatcgcctgaacccagcctatccccatcacccgctccagcgcctctacctcctaaacctctttctcctcctttgtc |
124 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31563219 |
catcacctgaacccagtctccctccatcgcctgaacccagcctatccccatcacccgctccagcgcctctacctcctaaacctctttctcctcctttgtc |
31563318 |
T |
 |
Q |
125 |
accagcctcatttttcccaacactgacaccgccagcagctgcagacatttctgctcctccatcttctgacacaagcgggaaggaagataaccatagtaat |
224 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31563319 |
accagcctcatttttcccaaaactgacaccgccagcagctgcagacatttctgctcctccatcttctgacacaagcgggaaggaagataaccatagtaat |
31563418 |
T |
 |
Q |
225 |
aaaacaacagttgttctttctgtagttat |
253 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
31563419 |
aaaacaacagttgttctttctgtagttat |
31563447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2470 times since January 2019
Visitors: 2401