View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_64 (Length: 251)
Name: NF0218_low_64
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218_low_64 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 251
Target Start/End: Original strand, 7863156 - 7863399
Alignment:
| Q |
8 |
gagcagagaatgtagcaactgtccttatatttgaaactgcacccgaggcaatattgcttgctcttgcataagagttgttattgattttcggaccaatgtt |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7863156 |
gagcagaaaatgtagcaactgtccttatatttgaaactgcacccgaggcaatattgcttgctcttgcataagagttgttattgattttcggaccgatgtt |
7863255 |
T |
|
| Q |
108 |
tatgatcaagtttatgtaacttgcaccaagggttaaaggagttacagcagctgcaacaagtgttagttcccaattaaatacaaaagacacaccaagtcca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7863256 |
tatgatcaagtttatgtaacttgcaccaagggttaaaggagttacagcagctgcaacaagtgttagttcccaattaaatacaaaagacacaccaagtcca |
7863355 |
T |
|
| Q |
208 |
actgcggccgaactcaatcccataagaagtaccgagaatctgtc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7863356 |
actgcggccgaactcaatcccataagaagtaccgagaatctgtc |
7863399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2497 times since January 2019
Visitors: 2401