View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_66 (Length: 244)
Name: NF0218_low_66
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 18296187 - 18295983
Alignment:
Q |
1 |
gaatgtatattgacttgctccataagtaatctcatattaggactcttattaggcgaatcttgagcgattgatgaacacttatcagtgataaagttagaga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18296187 |
gaatgtatattgacttgctccataagtaatctcatattaggactcttattaggcgaatcttgagcgattgatgaacacttatcagtgataaagttagaga |
18296088 |
T |
 |
Q |
101 |
ctcttgctgagagctgagaatgaatgttatgaggaatatgcaagaccatatataacaagaggcgaggctcaccacacgaagcatacatcgaaaagttgac |
200 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||| |
|
|
T |
18296087 |
ctcttgctgagagctgagaatgaatgttacgaggaatatgcaagaccatatataacaag-----aggctcaccacactaagcatccatcgaaaagttgac |
18295993 |
T |
 |
Q |
201 |
ctgacgacca |
210 |
Q |
|
|
||||| |||| |
|
|
T |
18295992 |
ctgaccacca |
18295983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University