View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_67 (Length: 244)
Name: NF0218_low_67
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218_low_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 4 - 138
Target Start/End: Original strand, 46429388 - 46429523
Alignment:
Q |
4 |
aacatagccgtctataattattagaatgttagcaggcagcgatcaaaccaagatgttatacctcccaatctc-taagtccctcatgcaataccgccagaa |
102 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
46429388 |
aacatagccgtctataattattagaatgttagcaggcagcgatcaaaccaagacgttatacctcccaatctcttaagtccctcatgcaataccgccagaa |
46429487 |
T |
 |
Q |
103 |
tcaccttatgactccctcgacaattttaacattgat |
138 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
46429488 |
tcaccttatgactccctcgacaattttaacattgat |
46429523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1619 times since January 2019
Visitors: 2392