View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_70 (Length: 239)
Name: NF0218_low_70
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 33395633 - 33395789
Alignment:
| Q |
1 |
gaagttatttctgatgtctgcacgctagcagcccatgacgcatttgaaggtggtgctgctccaggagtcagcacaggtgagggtgacggggaggctgaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33395633 |
gaagttatttctgatgtctgcacgctagcagcccatggcgcatttgaaggtggtgctgcttcaggagtcggcacaggtgagggtgacggggaggctgaag |
33395732 |
T |
 |
| Q |
101 |
gtgagggtactggagaccaaccaaactgtggtggctgcacgtttatgaaaagctttt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33395733 |
gtgagggtactggagaccaaccaaactgtggtggctgcacgtttatgaaaagctttt |
33395789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 106
Target Start/End: Original strand, 33399526 - 33399622
Alignment:
| Q |
10 |
tctgatgtctgcacgctagcagcccatgacgcatttgaaggtggtgctgctccaggagtcagcacaggtgagggtgacggggaggctgaaggtgagg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||| |||| | | |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33399526 |
tctgatgtctgcacgctagcagcccatggtgcatttgaaggcggtgctgcttcaggggccggcacaggtgagggtgagggggaggctgaaggtgagg |
33399622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 60
Target Start/End: Original strand, 33395535 - 33395593
Alignment:
| Q |
2 |
aagttatttctgatgtctgcacgctagcagcccatgacgcatttgaaggtggtgctgct |
60 |
Q |
| |
|
||||||| |||||||||||| ||| ||||||||||| |||||||||| ||||||||| |
|
|
| T |
33395535 |
aagttatctctgatgtctgcgcgccagcagcccatggtgcatttgaagacggtgctgct |
33395593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 65
Target Start/End: Original strand, 33399422 - 33399482
Alignment:
| Q |
5 |
ttatttctgatgtctgcacgctagcagcccatgacgcatttgaaggtggtgctgctccagg |
65 |
Q |
| |
|
|||| ||||||| ||||||||||||| |||||| ||||||||||| ||||| ||| |||| |
|
|
| T |
33399422 |
ttatctctgatgcctgcacgctagcaacccatggtgcatttgaaggaggtgcggcttcagg |
33399482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 157
Target Start/End: Original strand, 33441932 - 33441992
Alignment:
| Q |
97 |
gaaggtgagggtactggagaccaaccaaactgtggtggctgcacgtttatgaaaagctttt |
157 |
Q |
| |
|
|||||||| |||||||||||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
33441932 |
gaaggtgaaggtactggagaccaaccatcttgttttggctgcacagttatgaaaagctttt |
33441992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 157
Target Start/End: Original strand, 33452152 - 33452212
Alignment:
| Q |
97 |
gaaggtgagggtactggagaccaaccaaactgtggtggctgcacgtttatgaaaagctttt |
157 |
Q |
| |
|
|||||||| |||||||||||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
33452152 |
gaaggtgaaggtactggagaccaaccatcttgttttggctgcacagttatgaaaagctttt |
33452212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University