View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_71 (Length: 231)
Name: NF0218_low_71
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218_low_71 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 46429409 - 46429290
Alignment:
| Q |
1 |
aataattatagacggctatgtttggccgtttcagaagaagaagnnnnnnncattaaaattgcctagctcacagtaagtagttttcttttccatcaactta |
100 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46429409 |
aataattatagacggctatgtt-ggctgtttcagaagaagaagaaaaaaacattaaaattgcctagctcacagtaagtagttttcttttccatcaactta |
46429311 |
T |
|
| Q |
101 |
cattgttctacttgaaagatt |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46429310 |
cattgttctacttgaaagatt |
46429290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 113
Target Start/End: Complemental strand, 46425971 - 46425927
Alignment:
| Q |
69 |
cacagtaagtagttttcttttccatcaacttacattgttctactt |
113 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
46425971 |
cacagtgagtagtcttcttttccatcaactttcattgttctactt |
46425927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1971 times since January 2019
Visitors: 2394