View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_72 (Length: 228)
Name: NF0218_low_72
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218_low_72 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 5 - 228
Target Start/End: Complemental strand, 7863704 - 7863481
Alignment:
| Q |
5 |
ttccattggttttaggcatatcccttggagtatattttagcgacgacacttcaaaaatgaaaagagatgtagggtacctttgtttagtacttgtcggcct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7863704 |
ttccattggttttaggcatatcccttggagtatattttagcgacgacacttcaaaaatgaaaagagatgtagggtacctttgtttagtacttgtcggcct |
7863605 |
T |
|
| Q |
105 |
tggattcggttgcatactctccatgacaggacaacaaggtttatgtggttgggcaggttcaaagctaacactgagagttaggaacctcttgtttcaatcc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7863604 |
tggattcggttgcatactctccatgacaggacaacaaggtttatgtggttgggcaggttcaaagctaacactgagagttaggaacctcttgtttcaatcc |
7863505 |
T |
|
| Q |
205 |
atacttagacaagaacctggatgg |
228 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7863504 |
atacttagacaagaacctggatgg |
7863481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1420 times since January 2019
Visitors: 2391