View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_low_73 (Length: 208)
Name: NF0218_low_73
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218_low_73 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 79 - 208
Target Start/End: Complemental strand, 29308104 - 29307975
Alignment:
Q |
79 |
gagagaagagagaatgtaaattagggattgggaattgggatcgtgaaaagcgaaaacgaattgtttggtttggttggggatgttgagtttggaaacgagt |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
29308104 |
gagagaagagagaatgtaaattagggattgggaattgggatcgtgaaaagcgaaaacgaattgtttggtttggttagggatgttgagtttggaaacgagt |
29308005 |
T |
 |
Q |
179 |
tgttgagaggatttgagggagtttggttgt |
208 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
29308004 |
tgttgagaggatttgagggagtttggttgt |
29307975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1221 times since January 2019
Visitors: 2389