View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0218_low_73 (Length: 208)

Name: NF0218_low_73
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0218_low_73
NF0218_low_73
[»] chr4 (1 HSPs)
chr4 (79-208)||(29307975-29308104)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 79 - 208
Target Start/End: Complemental strand, 29308104 - 29307975
Alignment:
79 gagagaagagagaatgtaaattagggattgggaattgggatcgtgaaaagcgaaaacgaattgtttggtttggttggggatgttgagtttggaaacgagt 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
29308104 gagagaagagagaatgtaaattagggattgggaattgggatcgtgaaaagcgaaaacgaattgtttggtttggttagggatgttgagtttggaaacgagt 29308005  T
179 tgttgagaggatttgagggagtttggttgt 208  Q
    ||||||||||||||||||||||||||||||    
29308004 tgttgagaggatttgagggagtttggttgt 29307975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University