View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0219-INSERTION-13 (Length: 733)
Name: NF0219-INSERTION-13
Description: NF0219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0219-INSERTION-13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 645; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 645; E-Value: 0
Query Start/End: Original strand, 77 - 733
Target Start/End: Complemental strand, 44866144 - 44865488
Alignment:
| Q |
77 |
gtgagcctcactgtctgtgcaaaactatgaatagccgtggtttgcgaaagtatatacttatgcatctatctgaaacgccgtcgcttaaggaaaaaatccc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44866144 |
gtgagcctcactgtctgtgcaaaactatgaatagccgtggtttgcgaaagtatatacttatgcatctatctgaaacgccgtcgcttgaggaaaaaatccc |
44866045 |
T |
|
| Q |
177 |
ggtggcgctgaaaaaggcgccggaaccggcaaaattggtgtttgaatgcattggtagattttaccttcaaggaagcaaagcctatacaacaaactcaccg |
276 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44866044 |
ggtggcactgaaaaaggcgccggaaccggcaaaattggtgtttgaatgcattggtagattttaccttcaaggaagcaaagcctatacaacaaactcaccg |
44865945 |
T |
|
| Q |
277 |
atgattactgcaaggcaagcttcaattttggttttggaatactatctgatgtctggttgtgttgaaagtgaagcaaaaatggaacgtaaactgaaggcag |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865944 |
atgattactgcaaggcaagcttcaattttggttttggaatactatctgatgtctggctgtgttgaaagtgaagcaaaaatggaacgtaaactgaaggcag |
44865845 |
T |
|
| Q |
377 |
aagctgcagatgcagcgggtgcgtggaggaagagacttgttgttgaaggtggtgtggctatggcaagtgaaatggatgccagaggtttgactctttttct |
476 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865844 |
aagctgcagatgcagcgggtgcgtggaggaagagacttgttgttgaaggtggtgtggctatggcaagtgaaatggatgccagaggtttgactctttttct |
44865745 |
T |
|
| Q |
477 |
tgcgtgctttgggattcatggtgtttttaggaatgaggatattgcgaacttggttcgtttgagcaaacctggagaaatctcgcaccttcttcgcgtttcc |
576 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865744 |
tgcgtgctttgggattcatggtgtttttaggaatgaggatattgcgaacttggttcgtttgagcaaacctggagaaatctcgcaccttcttcgcgtttcc |
44865645 |
T |
|
| Q |
577 |
gggagcctttctagcaggtgttcaggtatgtattgtatacatgcctttgggaatttaggatatataatactcatggttatgcttgatcattttactttac |
676 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865644 |
gggagcctttctagcaggtgttcaggtatgtattgtatacatgcctttgggaatttaggatatataatactcatggttatgcttgatcattttactttac |
44865545 |
T |
|
| Q |
677 |
acttttactgtacaatttgtgattgtgatcagtgaaataagctagggcatttcattc |
733 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865544 |
acttttactgtacaatttgtgattgtgatcagtgaaataagctagggcatttcattc |
44865488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1276 times since January 2019
Visitors: 2391