View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0219-INSERTION-17 (Length: 54)
Name: NF0219-INSERTION-17
Description: NF0219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0219-INSERTION-17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 49; Significance: 6e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 6e-20
Query Start/End: Original strand, 6 - 54
Target Start/End: Original strand, 28265464 - 28265512
Alignment:
| Q |
6 |
caaatctacctctgaatttgacgaatctgagctaaaactcctttcacat |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265464 |
caaatctacctctgaatttgacgaatctgagctaaaactcctttcacat |
28265512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University