View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0219_high_5 (Length: 408)
Name: NF0219_high_5
Description: NF0219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0219_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 31 - 315
Target Start/End: Complemental strand, 1194083 - 1193799
Alignment:
| Q |
31 |
aaaatatttacaaa-gtcatagtgcctttattgaaagagcaccaacaaaaacagaaaataaattaacaaggatgccaactatgtattttctaaatttttg |
129 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1194083 |
aaaatatttacaaaagtcatattgcctttattgaaagagcaccaacaaaaacagaaaataaattaacaaggatgccaactatgtattttctgaatttttg |
1193984 |
T |
|
| Q |
130 |
g-ttatatatcgagaagtattaaattatttccattttgccatgaaaattttgcaaaattcatgcgcaattggacacatatccaacttgaaaaatataaaa |
228 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1193983 |
gtttatatatcgagaagtattaaattatttccattttgccatgaaaattttgc--aattcatgcgcaattggacacatatccaacatgaaaaatataaaa |
1193886 |
T |
|
| Q |
229 |
tttgagnnnnnnncctttcaaatttgtcagctaaccaccaataattacaataaaccacaaaagaaacaggataatgcaagatttctt |
315 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1193885 |
tttgagtttttttcctttcaaatttgtcagctaaccaccaataattacaataaaccacaaaagaaacaggataatgcaagatttctt |
1193799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2256 times since January 2019
Visitors: 2400