View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0219_low_13 (Length: 259)

Name: NF0219_low_13
Description: NF0219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0219_low_13
NF0219_low_13
[»] chr3 (1 HSPs)
chr3 (30-259)||(32051982-32052210)


Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 259
Target Start/End: Complemental strand, 32052210 - 32051982
Alignment:
30 tcttcctccccttggggttgggaggggggttagtgttgtattttagggagcgacaaattggttgacaatgctctatggaggcgttacacatacaatgact 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32052210 tcttcctccccttggggttgggaggggggttagtgttgtattttagggagcgacaaattggttgacaatgctctatggaggcgttacacatacaatgact 32052111  T
130 tgctttttgaggtttaaagtgttaaaaggaatcaaacatatctgctacatggcctcttaatgtgagcttttatgtagttgcaacaaaacaaacagatgca 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
32052110 tgctttttgaggtttaaagtgttaaaaggaatcaaacatatctgctacatggcctcttaatgtgagcttttatgtagttgc-acaaaacaaacagatgca 32052012  T
230 ttttattgtatagatgaatgttcacctata 259  Q
    ||||||||||||||||||||||||||||||    
32052011 ttttattgtatagatgaatgttcacctata 32051982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2841 times since January 2019
Visitors: 2404