View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0219_low_14 (Length: 249)

Name: NF0219_low_14
Description: NF0219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0219_low_14
NF0219_low_14
[»] chr1 (1 HSPs)
chr1 (1-161)||(38568832-38568992)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 38568992 - 38568832
Alignment:
1 ttctctttttgtcgtagtctagcgtggtaaatcagggagtgtcgtgtccgaacacctgcatatcaacatctttgcagctataccaaacgagctgtactta 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38568992 ttctctttttgtcgtagtctagcgtggtaaatcggggagtgtcgtgtccgaacacctgcatatcaacatctttgcagctataccaaacgagctgtactta 38568893  T
101 tgggatgaatgagatttttctttaatttgtagaataaattttcagttacatgatgatgatg 161  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38568892 tgggatgaatgagatttttctttaatttgtagaataaattttcagttacatgatgatgatg 38568832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University