View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0219_low_16 (Length: 246)
Name: NF0219_low_16
Description: NF0219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0219_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 38568992 - 38568835
Alignment:
| Q |
1 |
ttctctttttgtcgtagtctagcgtggtaaatcagggagtgtcgtgtccgaacacctgcatatcaacatctttgcagctataccaaacgagctgtactta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568992 |
ttctctttttgtcgtagtctagcgtggtaaatcggggagtgtcgtgtccgaacacctgcatatcaacatctttgcagctataccaaacgagctgtactta |
38568893 |
T |
|
| Q |
101 |
tgggatgaatgagatttttctttaatttgtagaataaattttcagttacatgatgatg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568892 |
tgggatgaatgagatttttctttaatttgtagaataaattttcagttacatgatgatg |
38568835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2861 times since January 2019
Visitors: 2404