View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0219_low_8 (Length: 272)
Name: NF0219_low_8
Description: NF0219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0219_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 15288396 - 15288651
Alignment:
Q |
1 |
agataaaaaactataatcaaaattggaattataaaattgaattttgattttggttcaagtctttttaccttgagtgagtcagttgaatcggtgactgatt |
100 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15288396 |
agataaaaaactataatcaagattgaaattataaaattgaatttcgattttggttcaagtttttttaccttgagtgagtcagttgaatcggtgactgatt |
15288495 |
T |
 |
Q |
101 |
gatgtgtatagccgttgaaatcgaaatcatcttcgtcggagctgttagcgttgaagcagttacagcggttacgagacggtggttgaagttgcggttgcgg |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15288496 |
catgtgtatagccgttgaaatcgaaatcatcttcgtcggagctgttagcgttgaagcagttacagcggttacgagacggtggttgaagttgcggttgcgg |
15288595 |
T |
 |
Q |
201 |
ttgttcttccatgaaactctgaaccattttcgccaagcaaacagagcttggttcca |
256 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
15288596 |
ttgttcttccatgaaactttgaaccattttcgccaagcaaacagagcttggttcca |
15288651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University