View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0220_low_3 (Length: 342)
Name: NF0220_low_3
Description: NF0220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0220_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 14 - 155
Target Start/End: Original strand, 52696015 - 52696156
Alignment:
| Q |
14 |
aggagaagaaggtgcacgacgaaaacgagcgtgaccggttcgatttaacaagttaataaccgttttaaacttagaaacagtgaaatcagtaatttcagta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52696015 |
aggagaagaaggtgcacgacgaaaacgagcgtgaccggttcgatttaacaagttaataaccgttttaaacttagaaacagtgaaatcagtaatttcagta |
52696114 |
T |
 |
| Q |
114 |
caatcaagtttattgaccagatctagttggttacgttgattt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52696115 |
caatcaagtttattgaccagatctagttggttaagttgattt |
52696156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 185 - 298
Target Start/End: Original strand, 52696192 - 52696305
Alignment:
| Q |
185 |
cacacgaattagttgctccatacttttcaatccagcagaagcagcttcttgaatagctctttgttcatccatcctcaactttggaatcactaccggatct |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52696192 |
cacacgaattagttgctccatacttttcaatccagcagaagcagcttcttgaatagctctttgttcatccatcctcaactttggaataactaccggatct |
52696291 |
T |
 |
| Q |
285 |
acaaccatcttgaa |
298 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52696292 |
acaaccatcttgaa |
52696305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University