View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0220_low_4 (Length: 291)
Name: NF0220_low_4
Description: NF0220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0220_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 44 - 282
Target Start/End: Original strand, 45065450 - 45065687
Alignment:
Q |
44 |
ttctactagattgaatcattgatcccactttaatttatcccttcaaacattggaattgttttgggaatctaaatagaaagtctgtactttaatattttcc |
143 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
T |
45065450 |
ttctactagattgaatcattgatcccattttaatttatcccttcaaacattggaattgttttgggaatctaaatataaagtctttactttaatattttcc |
45065549 |
T |
 |
Q |
144 |
acgttccaatttcaac-taaaaataccaccttcaaaacccctttttgaggttgttaaagcaacacactggggggactcatccgtcacggtaagtttcagt |
242 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
45065550 |
acgttccaatttcaacttaaaaataccaccttcaaaacccctttttgaggttgttaaagcaacaca--acggggactcatccgtcacggtaagtttcagt |
45065647 |
T |
 |
Q |
243 |
ttcttctcaagaataggaacacgttcgttctttcctatgc |
282 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45065648 |
ttcttctcaagaataggaacacgttcgttctttcctatgc |
45065687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1255 times since January 2019
Visitors: 2391