View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0220_low_6 (Length: 254)
Name: NF0220_low_6
Description: NF0220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0220_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 11 - 209
Target Start/End: Original strand, 29602911 - 29603098
Alignment:
| Q |
11 |
caaaggctaagatgtgtctttttgatagtgttgtacatgtactacatgtactatagttgtctccaagagtcttcaagaaacacatgacacattgtgactt |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29602911 |
caaaggctaagatgtgtctttt-gatagtgttgtacatgtactatctgtactatagttgtctccaag----------aaacacatgacacattgtgactt |
29602999 |
T |
|
| Q |
111 |
gtgagtctttgtgccttttgaccgtcttggttatatcaaaatttcatttgattatgggcgagtgaatgcatgtcgtgtaacaaaatcgaatcacctcta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29603000 |
gtgagtctttgtgccttttgaccgtcttggttatatcaaaatttcatttgattataggcgagtgaatgcatgtcgtgtaacaaaattcaatcacctcta |
29603098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2040 times since January 2019
Visitors: 2396