View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0221_high_5 (Length: 210)
Name: NF0221_high_5
Description: NF0221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0221_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 8421112 - 8421210
Alignment:
| Q |
1 |
gaaaagaaaaagataaatttgtgattatactctttggcatgtggtcctttctttactatctgtaaacaacaaagttttagagacaaccaagcccttact |
99 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8421112 |
gaaaagaaaaacataaatttgtgattatactctttggcatgtggtcctttctttactatctgcaaacaacaaagttttagagacaaccaagaccttact |
8421210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 7 - 107
Target Start/End: Complemental strand, 49170996 - 49170896
Alignment:
| Q |
7 |
aaaaagataaatttgtgattatactctttggcatgtggtcctttctttactatctgtaaacaacaaagttttagagacaaccaagcccttactattttct |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
49170996 |
aaaaacataaatttgtgattatactctttggcatgtggtcctttctttactatctgcaaacaacaaagttttagagacaaccaagcccttattatattct |
49170897 |
T |
 |
| Q |
107 |
t |
107 |
Q |
| |
|
| |
|
|
| T |
49170896 |
t |
49170896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University