View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0221_high_6 (Length: 206)
Name: NF0221_high_6
Description: NF0221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0221_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 45113224 - 45113298
Alignment:
Q |
1 |
atgaatcttgacaattatcttagaccaataaatgattttcttcctgatgtcaaagtgaaagtgttggagaataat |
75 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45113224 |
atgaatcttgacaattatcttagaccaataaataattttcttcctgatgtcaaagtgaaagtgttggagaataat |
45113298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 45124507 - 45124578
Alignment:
Q |
1 |
atgaatcttgacaattatcttagaccaataaatgattttcttcctgatgtcaaagtgaaagtgttggagaataat |
75 |
Q |
|
|
|||||||||||||||| | ||||||||| |||| || ||||| ||||||||||||||||||| |||||||||| |
|
|
T |
45124507 |
atgaatcttgacaattgttttagaccaa---atgaattgcttccagatgtcaaagtgaaagtgtcggagaataat |
45124578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University