View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0221_low_14 (Length: 210)
Name: NF0221_low_14
Description: NF0221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0221_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 8421112 - 8421210
Alignment:
Q |
1 |
gaaaagaaaaagataaatttgtgattatactctttggcatgtggtcctttctttactatctgtaaacaacaaagttttagagacaaccaagcccttact |
99 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
T |
8421112 |
gaaaagaaaaacataaatttgtgattatactctttggcatgtggtcctttctttactatctgcaaacaacaaagttttagagacaaccaagaccttact |
8421210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 7 - 104
Target Start/End: Complemental strand, 49170996 - 49170899
Alignment:
Q |
7 |
aaaaagataaatttgtgattatactctttggcatgtggtcctttctttactatctgtaaacaacaaagttttagagacaaccaagcccttactatatt |
104 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
49170996 |
aaaaacataaatttgtgattatactctttggcatgtggtcctttctttactatctgcaaacaacaaagttttagagacaaccaagcccttattatatt |
49170899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University