View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0221_low_9 (Length: 257)
Name: NF0221_low_9
Description: NF0221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0221_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 230
Target Start/End: Complemental strand, 28516091 - 28515871
Alignment:
Q |
9 |
agcacagagggcgacaaaaagtacagatcatgggcgaagaaggtggaacttccaagtttcaaacaacaataacctctaggctagattgctactgctgaaa |
108 |
Q |
|
|
|||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
28516091 |
agcacaaagggcgacaaaaagtacagatcatgcgcgaagaaggtggaacttccaagtttcaaacaacgatatcctctaggctagattgctactgctgaaa |
28515992 |
T |
 |
Q |
109 |
acatttcaagtgcagacaataaaacatttatcttctcaaatgaatgccaaaagctacctttctccccacacctcttctgattatatatgataactgaatt |
208 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28515991 |
acatttcaagtgcagacaataaaaca-ttatcttctcaaatgaatgccaaaagctacctttctccccacacctcttctgattatatatgataactgaatt |
28515893 |
T |
 |
Q |
209 |
ctcctcatgattccctatttta |
230 |
Q |
|
|
|||| |||||||||||| |||| |
|
|
T |
28515892 |
ctccacatgattccctaattta |
28515871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University