View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0222_high_3 (Length: 206)
Name: NF0222_high_3
Description: NF0222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0222_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 23 - 197
Target Start/End: Original strand, 44845289 - 44845463
Alignment:
Q |
23 |
attctttctgtcttgcttatttcccttcaaagtttggtcaatcatcaactgactcaacccgaatccaaatgcggttgtgtctgtcgcgacaacagtacaa |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44845289 |
attctttctgtcttgcttatttcccttcaaagtttggtcaatcatcaactgactcaacccgaatccaaatgcggttgtgtctgtcgcgacaacagtacaa |
44845388 |
T |
 |
Q |
123 |
catgtaacgattcagacaagttttgtggggttcagtattcggatcagactcaaatggcagcctatgctactcctc |
197 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
T |
44845389 |
catgtaacgattcagacaagctttgtggggttcagtattcggatcagactcaaatggcagcctgtgctattcctc |
44845463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 175
Target Start/End: Original strand, 44858354 - 44858410
Alignment:
Q |
119 |
acaacatgtaacgattcagacaagttttgtggggttcagtattcggatcagactcaa |
175 |
Q |
|
|
||||||||||||||||| || ||| |||||||||| |||||||| |||||| |||| |
|
|
T |
44858354 |
acaacatgtaacgattcggagaaggtttgtggggtccagtattctaatcagaatcaa |
44858410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1873 times since January 2019
Visitors: 2394