View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0222_low_1 (Length: 847)
Name: NF0222_low_1
Description: NF0222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0222_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-106; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 409 - 652
Target Start/End: Original strand, 11583907 - 11584148
Alignment:
| Q |
409 |
cttctaatatccaaaagttcatatttgacgtggaaaaccctcttattcgaaggaaaaaatcattggacaaacaacaaaaagtatttagatgctagataca |
508 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11583907 |
cttctaatatccaaaagttcatatt-gacgtggaaaaccctcttattcgaaggaaaaaatcattggacaaacaacaaaaagtatttagatgctacataca |
11584005 |
T |
|
| Q |
509 |
attgaggaaacattgagaagaaattaataatttaaaaaacttttgagattttcatttgttctatccattcttccagtattcttatccatcttttttgtca |
608 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | | ||||||||||||||||||||||||||| || |||||| |
|
|
| T |
11584006 |
attgaggaaacattgagaagaaattaataatttaaaaaacttttgatattttcatttgctttgtccattcttccagtattcttatccatc-ttgttgtca |
11584104 |
T |
|
| Q |
609 |
agatttcgaagaatatcattctgagcaaccatagtctcggattg |
652 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
11584105 |
agatttcgaagaatatcattctaaacaaccatagtctcggattg |
11584148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 145 - 260
Target Start/End: Original strand, 11582741 - 11582858
Alignment:
| Q |
145 |
gtttgcttatcaataacgatagatcaagtatatgaaatctgtgatgtaaaattatttaacggtttgaatttaaaggcaacatt--tatataaatggcatg |
242 |
Q |
| |
|
|||||||||| ||||| | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11582741 |
gtttgcttatgaataaagctagatcaagtatatgaaatatgtgatgtaaaattatttaacggtttgaatttaaaggcaacatttatatataaatggcatg |
11582840 |
T |
|
| Q |
243 |
aaatgatatactatatat |
260 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
11582841 |
aaatgatatactatatat |
11582858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 273 - 313
Target Start/End: Original strand, 11583771 - 11583811
Alignment:
| Q |
273 |
tcactcactgtgcttgtttattttgtcacagtagcaatcag |
313 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11583771 |
tcactcattgtgcttgtttattttgtcacagtagcaatcag |
11583811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1475 times since January 2019
Visitors: 2391