View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0222_low_4 (Length: 254)
Name: NF0222_low_4
Description: NF0222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0222_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 111 - 240
Target Start/End: Original strand, 32992665 - 32992791
Alignment:
| Q |
111 |
tgttttgggtctaaaattgtacatttgtgtagtggggaccactcatcaatgaagcaaggtcactattgggggcattggcatataataaaactaattaatc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32992665 |
tgttttgggtctaaaattgtacatttgtgtagtggggaccactcaccaatgaagccaggtcactattgggggcattggcat---ataaaactaattaatc |
32992761 |
T |
|
| Q |
211 |
taaatcaacttgagttggatattcttcgac |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |
|
|
| T |
32992762 |
taaatcaacttgagttggattttcttcgac |
32992791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1423 times since January 2019
Visitors: 2391