View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_high_31 (Length: 269)
Name: NF0223_high_31
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_high_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 34 - 179
Target Start/End: Original strand, 36400972 - 36401117
Alignment:
| Q |
34 |
gtgcctaaaaaagttttcaatttttaaaatatgaaaattaacttagaagaaagattttttagcaggaggtcttccaactgctctcataagattagcaatc |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36400972 |
gtgcctaaaaaagttttcaatttttaaaatatgaaaactaacttagaagaaagattttttagcaggaggtcttccaactgctctcataagattagcaatc |
36401071 |
T |
|
| Q |
134 |
tcaagaactctagccactttagttcctctttttgcctctgatgatg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36401072 |
tcaagaactctagccactttagttcctctttttgcctctgctgatg |
36401117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 75 - 173
Target Start/End: Original strand, 21427486 - 21427584
Alignment:
| Q |
75 |
cttagaagaaagattttttagcaggaggtcttccaactgctctcataagattagcaatctcaagaactctagccactttagttcctctttttgcctctg |
173 |
Q |
| |
|
|||| ||||| ||| |||| | ||||| ||||||||| |||||||||| || |||||||||||||| || | | ||||||||||||||| ||||||| |
|
|
| T |
21427486 |
cttaaaagaaggatcttttggaaggagctcttccaacaactctcataaggttggcaatctcaagaacccttgaaattttagttcctcttttagcctctg |
21427584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2856 times since January 2019
Visitors: 2404