View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_high_40 (Length: 251)
Name: NF0223_high_40
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0223_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 35045250 - 35045489
Alignment:
Q |
1 |
aatctgcagctggatccacctttgatgcactcacgcatttatcatccacagatggcacagataaacactcgccattcactttctcagtatctacttgcat |
100 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
35045250 |
aatctgcagctggatccacctttgattcactcacgcatttatcatccacagatggcacagataaacactcgccattcactttctcggtatctacttgcat |
35045349 |
T |
 |
Q |
101 |
tggtgaagatgccagttctggcccattggtatcacccatggtgcaactatcagtcttagtttcaggcttagaaccttcatgattatcagatgtcaaagga |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35045350 |
tggtgaagatgccagttctggcccattggtatcacccatggtgcaactatcagtcttagtttcaggcttagaaccttcatgattatcagatgtcaaagga |
35045449 |
T |
 |
Q |
201 |
agttccaatccctgaccccccataaccttcttgtcttcat |
240 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
35045450 |
agttccaatccctgacctcccataaccttcttgtcttcat |
35045489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 105
Target Start/End: Original strand, 35022241 - 35022272
Alignment:
Q |
74 |
attcactttctcagtatctacttgcattggtg |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
35022241 |
attcactttctcagtatctacttgcattggtg |
35022272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 106 times since January 2019
Visitors: 2407