View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_high_42 (Length: 250)
Name: NF0223_high_42
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_high_42 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 26 - 250
Target Start/End: Complemental strand, 21630693 - 21630469
Alignment:
| Q |
26 |
atcatcttcatcatcgacaacaaaggaaaacatctagcaattagtagttagttagtataattagtatgccaatatcaccggcagctgtgatcatcccatt |
125 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21630693 |
atcatcatcatcatcgacaacaaaggaaaacatctagcaattagtagtaagttagtataattagtatgccaatttcaccggcagctgtgatcatcccatt |
21630594 |
T |
 |
| Q |
126 |
gggtattctcttcttcgcttctggtctcatcgttaacatcattcaggtcggttctttctcttttcattttaccgaaatcatcnnnnnnnttcatttttta |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21630593 |
gggtattctcttcttcgcttctggtctcatcgttaacatcattcaggtcagttctttctcttttcattttaccgaaatcatcataaaaattcatttttta |
21630494 |
T |
 |
| Q |
226 |
gattcagatttgatgtgcttattgt |
250 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
21630493 |
gattcagatttgatgtgattattgt |
21630469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University