View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_high_48 (Length: 227)
Name: NF0223_high_48
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_high_48 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 39360806 - 39360586
Alignment:
| Q |
7 |
ctttttcatgttcattcacaacaccaccaaaataaccgaattcattctcattggaaccaccattgaactccatcacagaaaaaccaacttctgaaactga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39360806 |
ctttttcatgttcattcacaacaccaccaaaataaccgaattcattctgattggaaccaccattgaactccatcacagaaaaaccaacctctgaaactga |
39360707 |
T |
|
| Q |
107 |
accagacccaaataaagaattctcatcaccaccagaaccagtattgatagcatgaattgtgtcagtttggttcagatcataaccaaattccaagttcaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39360706 |
accagacccaaataaagaattctcatcaccaccagaaccagtattgatagcatgaattgtgtcagtttggttcagatcataaccaaattccaagttcaga |
39360607 |
T |
|
| Q |
207 |
ttcttctgatagttttgttga |
227 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
39360606 |
ttcttctgatagtgttgttga |
39360586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2771 times since January 2019
Visitors: 2404