View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0223_high_50 (Length: 213)

Name: NF0223_high_50
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0223_high_50
NF0223_high_50
[»] chr7 (1 HSPs)
chr7 (16-97)||(40145071-40145152)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 16 - 97
Target Start/End: Original strand, 40145071 - 40145152
Alignment:
16 ccacaaaccctccggtgagatttctttcctcacaccaacatgcaacaaccctaccaagaaaataaccataagttgatcttca 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
40145071 ccacaaaccctccggtgagatttctttcctcacaccaacatgcaacaaccctaccaagaaaataaccacaagttgatcttca 40145152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University