View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_high_50 (Length: 213)
Name: NF0223_high_50
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0223_high_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 16 - 97
Target Start/End: Original strand, 40145071 - 40145152
Alignment:
Q |
16 |
ccacaaaccctccggtgagatttctttcctcacaccaacatgcaacaaccctaccaagaaaataaccataagttgatcttca |
97 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
40145071 |
ccacaaaccctccggtgagatttctttcctcacaccaacatgcaacaaccctaccaagaaaataaccacaagttgatcttca |
40145152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University