View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_22 (Length: 386)
Name: NF0223_low_22
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 37 - 302
Target Start/End: Complemental strand, 13669694 - 13669429
Alignment:
| Q |
37 |
aaacctgtcttagcaatatcattgttaacagcagcaagcaatggaatagctgtcaatcttctcactgacttgaacttgaaaacatcaatcattgatttcc |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669694 |
aaacctgtcttagcaatatcattgttaacagcagcaagcaatggaatagctgttaatcttctcactgacttgaacttgaaaacatcaatcattgatttcc |
13669595 |
T |
|
| Q |
137 |
attgcatcatgttactttccttccaacctaattttccctccaccggtggtgaattctccgatgagtacgaggagaaactgctgcttccactattgtctga |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669594 |
attgcatcatgttactttccttccaacctaattttccctccaccggtggtgaattctccgatgagtacgaggagaaactgctgcttccactattgtctga |
13669495 |
T |
|
| Q |
237 |
ctctgttcctgaaacaggggcatctagtattgctcttggtgatgcttcatcgtcgcttgaaaactg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669494 |
ctctgttcctgaaacaggggcatctagtattgctcttggtgatgcttcatcgtcgcttgaaaactg |
13669429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2635 times since January 2019
Visitors: 2402