View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_31 (Length: 333)
Name: NF0223_low_31
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 42021539 - 42021217
Alignment:
| Q |
1 |
aatctcttcaccttaaacacaatcttcttatccataaacaaacataacatgtgactctttgatgttgatccttcttcttctactccacactttatcaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021539 |
aatctcttcaccttaaacacaatcttcttatccataaacaaacataacatgtgactctttgatgttgatccttcttcttctactccacactttatcaata |
42021440 |
T |
 |
| Q |
101 |
tatcgtgtgaaattcctgtttcagaaaactttgcctttgttgcataaacacttgtaccataaaatctttcacttcttgaaaccattgagaattttgcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021439 |
tatcgtgtgaaattcctgtttcagaaaactttgcctttgttgcataaacacttgtaccataaaatctttcacttcttgaaaccattgagaattttgcatc |
42021340 |
T |
 |
| Q |
201 |
atggtttttcttatcttccaagttcttcaacgaatcttcttctttgtctccgaggaataaacccaattcagagttcaccaaaaccatgacgtaaaatcca |
300 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021339 |
atggtttttcttatcttccaagttctccaacgaatcttcttctttgtctccgaggaataaacccaattcagagttcaccaaaaccatgacgtaaaatcca |
42021240 |
T |
 |
| Q |
301 |
ttaaccggttcaggtccttcatc |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42021239 |
ttaaccggttcaggtccttcatc |
42021217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University