View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_39 (Length: 280)
Name: NF0223_low_39
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 83 - 252
Target Start/End: Original strand, 5061010 - 5061184
Alignment:
| Q |
83 |
gaacttgttcagatgaaattaaggaagtggccagtgggtgggggaaaacaatggttaaaataaattgagaattgacataaacattgaaaataataaattc |
182 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5061010 |
gaacttggtcagatgaaattaaggaagtggccagtgtgtggggaaaaacaatgggtaaaataaattgagaattaacataaacattgaaaataataaattc |
5061109 |
T |
 |
| Q |
183 |
agtaggtggattgatcaaaaagagggt-----aggtgggatgaaccaagtgcttctgagttctgaccacactcac |
252 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5061110 |
agtaggtggattgatcaaaaagagggtgggtggggtgggatgaaccaagtgcttctgagttctgaccacactcac |
5061184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University