View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_42 (Length: 265)
Name: NF0223_low_42
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 36400965 - 36400796
Alignment:
| Q |
1 |
aaaaggataataatttttcctttttaattagttaaagagtgcaagatggattgcagtgagaagtatataa---aaatagcaagataaggtgatatgtatc |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36400965 |
aaaaggataataatttttcctttttaattagttaaagagtgcaagatggattgcagtgagaagtatataattaaaatagcaagataaggtgatatgtatc |
36400866 |
T |
|
| Q |
98 |
aatcatatcatatcatatagtttataaaaaccaattggagtgtttataagtgataatagattagtgtttg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36400865 |
aatcatatcatatcatatagtttataaaaaccaattggagtgtttataagtgataatagattagtgtttg |
36400796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2821 times since January 2019
Visitors: 2404