View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_45 (Length: 257)
Name: NF0223_low_45
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 85 - 249
Target Start/End: Complemental strand, 43904366 - 43904205
Alignment:
| Q |
85 |
agccagccttgaccctccaatataattagtaaagctaaaacccactctcattttagacaaaacaaaaccaaaataaactcttattctgttcaagttcaag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43904366 |
agccagccttgaccctccaatataattagtaaagctaaaacccactctcattttagacaaaacaaaaccaaaataaactcttattctgttcaagttcaag |
43904267 |
T |
 |
| Q |
185 |
aaaagccnnnnnnnnnnnnnncagcatgctttagta-ttgtactttaatttaaccgaacctatgct |
249 |
Q |
| |
|
||||| | ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43904266 |
aaaagac----aaaaaaaaaacagcatgctttagtatttgtactttaatttaaccgaacctatgct |
43904205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University