View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_48 (Length: 251)
Name: NF0223_low_48
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 42827379 - 42827180
Alignment:
| Q |
1 |
aaaatttgcaggcaccaaaccaaaaatgcgcgaactta-----accatttacatatttaagtcattaatatatatat--tttctttagaattaacggtgc |
93 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42827379 |
aaaacttgcagggaccaaaccaaaaatgcgcgaacttacaagaaccgtttacatatttaagtcattaatatatatatattttctttagaattaacggtgc |
42827280 |
T |
|
| Q |
94 |
taggttattacttttcaccgccaaatatttctaaagaattctgaatggagttcgaaggcgaagatggttccaaattctctttacaaagcagtgacaaagc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42827279 |
taggttattacttttcaccgccaaatatttctaaagaattctgaatggagttcgaaggcgaagatggttccaaattctctttacaaagcagcgacaaagc |
42827180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2680 times since January 2019
Visitors: 2402