View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0223_low_50 (Length: 251)

Name: NF0223_low_50
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0223_low_50
NF0223_low_50
[»] chr1 (1 HSPs)
chr1 (26-251)||(21630468-21630693)


Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 26 - 251
Target Start/End: Complemental strand, 21630693 - 21630468
Alignment:
26 atcatcttcatcatcgacaacaaaggaaaacatctagcaattagtagttagttagtataattagtatgccaatatcaccggcagctgtgatcatcccatt 125  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||    
21630693 atcatcatcatcatcgacaacaaaggaaaacatctagcaattagtagtaagttagtataattagtatgccaatttcaccggcagctgtgatcatcccatt 21630594  T
126 gggtattctcttcttcgcttctggtctcatcgttaacatcattcaggtcggttctttctcttttcattttaccgaaatcatcnnnnnnnttcatttttta 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||       |||||||||||    
21630593 gggtattctcttcttcgcttctggtctcatcgttaacatcattcaggtcagttctttctcttttcattttaccgaaatcatcataaaaattcatttttta 21630494  T
226 gattcagatttgatgtgattattgtg 251  Q
    ||||||||||||||||||||||||||    
21630493 gattcagatttgatgtgattattgtg 21630468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2505 times since January 2019
Visitors: 2401