View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_56 (Length: 245)
Name: NF0223_low_56
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_low_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 49511373 - 49511599
Alignment:
| Q |
1 |
cgttccatttggggctacctatcattctagttcttccaactcttgctttgtctaaatcaactgttgcatatagacccatcccaataatctgtgaaatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511373 |
cgttccatttggggctacctatcattctagttcttccaactcttgctttgtctaaatcaactgttgcatatagacccatcccaataatctgtgaaatgtt |
49511472 |
T |
|
| Q |
101 |
tttaaatgttgttaggtgttagaatgtataaagggaactttatgtgattagaaaaataatgaagtatgttacataattacattacatattatatagtcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511473 |
tttaaatgttgttaggtgttagaatgtataaagggaactttatgtgattagaaaaataatgaagtatgttacataattacattacatattatatagtcaa |
49511572 |
T |
|
| Q |
201 |
caaggaaataaaataatatgtgaagat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
49511573 |
caaggaaataaaataatatgtgaagat |
49511599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 49522352 - 49522404
Alignment:
| Q |
18 |
cctatcattctagttcttccaactcttgctttgtctaaatcaactgttgcata |
70 |
Q |
| |
|
||||||||||| |||| |||||| |||||||| |||||||||||||||||||| |
|
|
| T |
49522352 |
cctatcattctggttcgtccaacccttgctttatctaaatcaactgttgcata |
49522404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 121 times since January 2019
Visitors: 2407