View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_57 (Length: 234)
Name: NF0223_low_57
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0223_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 2 - 134
Target Start/End: Original strand, 830456 - 830591
Alignment:
Q |
2 |
aagcagagggaagagattgaagggatttgcggagggattcttcggtgctggccatgggagtagttg---ttgttgtggaaatgaaagggagggaagaaga |
98 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
830456 |
aagcagagagaagagattgaagggatttgcggagagattcttcggtgctggccatgggagtagttgttgttgttgtggaaatgaaagggagggaagaaga |
830555 |
T |
 |
Q |
99 |
taattatgatcaaggttttgtggtggatgtaactgt |
134 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
830556 |
taattatgatcaaggttttgtggtggatgtaactgt |
830591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University