View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_59 (Length: 233)
Name: NF0223_low_59
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 54 - 220
Target Start/End: Complemental strand, 36347144 - 36346982
Alignment:
| Q |
54 |
atgaagaacatagacttgatatatgatggagaacctgctaaggctttatgcaacaatgttcaattttcttacacagtacaagctacaccaaactgcggcg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36347144 |
atgaagaacatagacttgatatatgatggagaacctgctaaggctttatgcaacaatgttcaattttcttacacagtacaagctaccccaaactgcggcg |
36347045 |
T |
 |
| Q |
154 |
cagataaatatacaaattaattaaggactctctacatcatccatcatggaaagactctgtatatact |
220 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36347044 |
cagataaatatacaaa----ttaaggactctctacatcatccatcatggaaagactctgtatatact |
36346982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 81 - 126
Target Start/End: Complemental strand, 36354040 - 36353995
Alignment:
| Q |
81 |
ggagaacctgctaaggctttatgcaacaatgttcaattttcttaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36354040 |
ggagaacctgctaaggctttatgcaacaatgttcaattgtcttaca |
36353995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University