View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_6 (Length: 487)
Name: NF0223_low_6
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0223_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 22 - 458
Target Start/End: Original strand, 44727226 - 44727643
Alignment:
| Q |
22 |
cggcaacagttggattccgagttgagtgtgttgcaatgatgtccaagaaacagaagaacatttgtttgctaaatgtggtttttcgggcactgtttggtat |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44727226 |
cggcaacagttggattccgagttgtgtgtgttgcaatgatgtccaagaaacagaagaacatttgtttgctaaatgtggtttttcgggcactgtttggtat |
44727325 |
T |
 |
| Q |
122 |
gtggtattcaagtggcttggcttcaactcggttttgtcggggaatttgtttattttgctccaaacttttacttcgtttgaaaagctaggaactagaaatc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44727326 |
gtggtattcaagtggcttggcttcaactcggttttgtcggggaatttgtttattttgctccaaacttttatttcgtttgaaaagctaggaactagaaatc |
44727425 |
T |
 |
| Q |
222 |
ttcataaattttcgcttcacgttaaaattttagttgaaataattcaataattcatctctcaagttatcctacttttttgaatgttgtcttttggtttatg |
321 |
Q |
| |
|
|||||||||||| | | ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44727426 |
ttcataaattttgcaatta---taaaattttagttgaaataattcaataattcat----------------cttttttgaatgttgtcttttggtttatg |
44727506 |
T |
 |
| Q |
322 |
gcccgacctagaaactacatagaccatcaccaggtgatgggatatatgctccgcaatattccttttgcaactgcaaaatgccaatccctagaaactacta |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44727507 |
gcccgacctagaaactacatagaccatcaccaggtgatgggatatatgctccacaatattccttttgcaactgcaaaatgccaatccctagaaactacta |
44727606 |
T |
 |
| Q |
422 |
atgtttccttgaggtttcagcataggctagatatcca |
458 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||| |
|
|
| T |
44727607 |
atgtttccttgaggtttcagcatagcctggatatcca |
44727643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University