View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0223_low_67 (Length: 212)
Name: NF0223_low_67
Description: NF0223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0223_low_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 32 - 161
Target Start/End: Original strand, 6351924 - 6352053
Alignment:
Q |
32 |
aagaatatacaaaggtgtagctaaaatgtgatggctcaggagtagggctccgtaattttgtgtgaattacttcaaataatttagaatgaatagtaatgga |
131 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6351924 |
aagaatatacaaaggtgtaactaaaatgtgatggctcaggagtagggctccgtaattttgtgtgaattacttcaaataatttagaatgaatagtaatgga |
6352023 |
T |
 |
Q |
132 |
aagtggagtatgtaatcgatgtgatttacc |
161 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
6352024 |
aagtggagtatgtaatcgatgtgatttacc |
6352053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University