View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0225-INSERTION-1 (Length: 291)

Name: NF0225-INSERTION-1
Description: NF0225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0225-INSERTION-1
NF0225-INSERTION-1
[»] chr7 (2 HSPs)
chr7 (47-203)||(2675982-2676137)
chr7 (240-277)||(2676344-2676381)


Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 47 - 203
Target Start/End: Original strand, 2675982 - 2676137
Alignment:
47 taactggaggtgtcttctaatgttagaagaaacctccagtttactctaaaacaaaaagaatatatgaatttttattcacttttttatctattagttttct 146  Q
    |||| |||||| ||||| ||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||| |||||| ||||||||||||||||    
2675982 taacaggaggtttcttcgaatgttagaagaaaccttcagtttactctaaaacaaaaaaaatatatggatttttatttactttt-tatctattagttttct 2676080  T
147 aatcaatcttaagttggatttgtcttttaatttagaaataaaaaattaccgatgtgg 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2676081 aatcaatcttaagttggatttgtcttttaatttagaaataaaaaattaccgatgtgg 2676137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 2676344 - 2676381
Alignment:
240 gatttccaaggacaggggtttgttaacccaggttcaga 277  Q
    |||||||||||||||| |||||||||||||||||||||    
2676344 gatttccaaggacaggagtttgttaacccaggttcaga 2676381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1682 times since January 2019
Visitors: 2392